1997 Kawasaki KLX300R, 1998 Kawasaki KLX300R, 1999 Kawasaki KLX300R, 2000 Kawasaki KLX300R, 2001 Kawasaki KLX300R, 2002 Kawasaki KLX300R, 2003 Kawasaki KLX300R, 2004 Kawasaki KLX300R, 2005 Kawasaki KLX300R, 2006 Kawasaki KLX300R, 2007 Kawasaki KLX300R Weight: 0.4 lbs Dimensions: 5 x 5 x 1 in Skip to main content.sg. Hey folks, I'd like to get my … Prime. . The dual-sport bike was available until 2014 when emission rules made it clear that carbureted bikes would have to go away, sooner or later. Recommended Posts. Search 2006 Kawasaki KLX300R motorcycles, find motorcycle news, motorcycle insurance and finance, motorbike valuations and motorbike classifieds relating to motorbike today. Disappointed with the lack of power? Account & Lists Account Returns & Orders. You are yet to start searching vehicles. Indytim Indytim TT Newbie; Members; 8 posts; Location: Missouri; Posted December 20, 2008. Kawasaki KLX 300 R 2006 Motorcycle Photos and Specs. Buy Aluminum Rear Sprocket - 48T Fits 2006 Kawasaki KLX300R: Sprockets - Amazon.com FREE DELIVERY possible on eligible purchases 1997-2005 KAWASAKI KLX300R 1994-1996 KLX250R TENSIONER BOLT AND … Water cooled, 249cc, Single, SOHC . THEN AND NOW. Off-Road.coms Ride-Net 2002 Kawasaki Dirt Bikes - KLX 300: Dirtbike : For those seeking four-stroke power in a lightweight and nimble chassis, the Kawasaki KLX300R InvivoGen CpG oligonucleotides are functionally tested and guaranteed endotoxin-free to avoid non-specific immune stimulation. MotoChris521 motominded. Power-to-weight ratio: 0.31 KW/lbs (3.28 lbs/HP) Fuel capacity: 2.59 gals: Number of riders: 2 persons: To report a mistake please sign in first. With a fair amount of weight, soft suspension and sit-down-oriented ergonomics, the DR-Z doesn't like to be pushed. It hits the scales at 282 pounds with the 2.1-gallon fuel tank filled. KNFilters.com - the official site for performance filtration products. This is the spot to talk about Kawasaki KLR & KLX motorcycles; whether you trail ride a KLX 125, 140, 230R or 300R, or dual sport a KLR 250, KLX 230 or KLX 250 , we've got you covered! View our full range of Kawasaki KLX300R Motorcycles online at bikesales.com.au – Australia's number 1 motorbike classified website. The off-road motorcycle KLX300R is the equivalent of Kawasaki´s "old guy" KDX200. Their motorcycle brand consist of various sport bikes, cruisers, off-road, and motocross bikes. Joined: Aug 30, 2007 Oddometer: 3,339 Location: south west #7. Dirt bike manufacturers are under extreme pressure to make their bikes environmentally friendly. Engine: It uses a four-stroke, liquid-cooled DOHC V-Twin engine and has a bore-stroke ratio of 78 x 61.2 millimeters (3.07 x 2.41 inches).The engine’s displacement is 292 cubic centimeters. Free shipping on many items | Browse your favorite brands | affordable prices. The KLX 300R weighs 233.7 lbs. With a compact four-stroke engine tucked into a perimeter frame light weight and quick handling the Kawasaki KLX300R combines four-stroke power with the kind of nimble maneuverability usually found only in a two-stroke motocrosser. No one will call the 2020 Kawasaki KLX300R a lightweight. A constant-velocity 34-mm semi-flat side Keihin CVK34 carburetor handles the air-fuel mixture with a compression ratio of 11.0:1. OEM part weight= 27gm To buy an OEM aluminium caliper piston it will cost £38 + shipping The transfer of heat from the pad to the brake fluid may be lower with the plastic OEM part but they’re more prone to getting stuck and wear. Was: Previous Price $39.98. 2006 KLX300R as an entry-level enduro machine Facebook; Twitter; Youtube; Instagram; Newsletter; Sign in to follow this . Account & Lists Account Returns & Orders. With its liquid-cooled four-stroke engine, perimeter frame and plush suspension, this Kawasaki gives off-road riders the balance of power and handling they want. All Hello, Sign in. #6. Find the best deals today! I use to have a KLX300R it was a 2001 model. Try. Similar bikes. CpG 2006 ODN (also known as CpG ODN 7909) is a human TLR9 ligand. Find new & used KLR & KLX motorcycles & parts for sale, KLR & KLX reviews, and browse owner garages & mods. Free shipping. ADV Sponsors. Just saw the wet weight of this bike. Enter the KLX300R. What a let down after … Sell or buy used bikes? 2006 Kawasaki KLX250S All; Uncategorized; ATVs; Motorcycles; PWCs; Snowmobiles; UTVs... 1 ITEM. Street legal model with electric start makes debut in Kawasaki showrooms. US, Colorado, Gunnison County Colorado 3 years at americanlisted.com. $9.25 shipping. Paughco® Custom Long Coctail Exhaust Muffler (610) 0 # mpn4619675556 . Sure, 282 pounds means the KLX300R is not a lightweight off-road motorcycle; fortunately, it hides its weight well when underway. Kawasaki: KLX300R KLX 300R KLX330 KLX250 KDX … The street-legal, 250cc version came in 2006 with electric start, and by 2008, the dirt-only version was dropped. Followers 0. 2000 Kawasaki KLX 300R Street legal fun . Watch. The sequence of CpG-B (type K) ODN 2006 (also known as PF-3512676) is tcgtcgttttgtcgttttgtcgtt. 2004 Honda CRF 250 R Offroad. Bikez has a high number of users looking for used bikes. Founded in 1896, Kawasaki Heavy Industries Ltd. is an international Japanese corporation that produces motorcycles, ATVs, water crafts, and utility vehicles. Incredible horsepower gains when compared to stock Aluminum/stainless construction for reduced weight and increased durability. The 2006 Kawasaki KLX 300R is a Off-Road Style Motorcycle equipped with an 292cc, Liquid Cooled, Single-Cylinder, DOHC, 4-Stroke Engine and a 6-Speed Manual Transmission. or Best Offer. Click here to sell a used 2006 Kawasaki KDX 200 or advertise any other MC for sale.You can list all 2006 Kawasaki KDX 200 available and also sign up for e-mail notification when such bikes are advertised in the future. more (See less) Kawasaki Note. Kawasaki KLX300R Specs & Features. 2006 Dirt Bikes From Team Green - KAWASAKI KLX300R: Dirtbike : Designed to be ultra-compact, the KLX300R s liquid-cooled 292cc engine features dual overhead cams Water cooled, 249cc, Single, DOHC. Products tagged “2006 Kawasaki KLX300R” 2006 Kawasaki KLX300R. KLX 300R KAWASAKI 2006 KLX 300R 2006 MILE METER PICKUP AND CABLE. WolfNman likes this. Get the best deal for Engines & Parts for Kawasaki KLX300R from the largest online selection at eBay.com. $41.21. 8 new & refurbished from $26.99. | Browse our daily deals for even more savings! This Titanium part is cheaper. Bikez.biz has an efficient motorcycle classifieds. . All Hello, Sign in. Ads are free. Find 2006 Kawasaki KLX300R at bikesales.com.au. 2003 KTM 250 EXC Racing Offroad. Clem Kevin Nude With Boots. It may be dressed in the same Kawasaki Lime Green as its sibling KLX300R off-road speedster, but the all-new KLX250 with electric start finds itself equally at home on the pavement … kawasaki klxâ„¢250 joins 2006 model line-up and helps create a one-two punch for kawasaki dealers Street legal model with electric start makes debut in Kawasaki showrooms. Kawasaki KLX300 / KLX300R Front and Rear Wheel Bearings and Seals: Amazon.sg: Automotive. It has a Inverted Fork Front Suspension while the Rear Suspension consists of a Twin Sided Swing Arm. 2006 Kawasaki Motorcycles Prices and Values Select any 2006 Kawasaki Motorcycles model . Add a Vehicle. Prime. Vehicle Parts Filter. $354.34. Bump up to race pace, though, and the 283-pound KLX is less happy. | Free shipping on many items! Buy Steel Rear Sprocket - 48T Fits 2006 Kawasaki KLX300R: Sprockets - Amazon.com FREE DELIVERY possible on eligible purchases Get the latest Specifications for Kawasaki KLX 300 R 2006 Motorcycle from mbike.com! The KLX 300R has Front Hydraulic Disc Brakes and Rear Disc Brakes. Long travel suspension with 233cc fuel-injected, air-cooled, 4-stroke engine. 2006 Kawasaki KLX300R, The minimalist answer to dual sport. 2005 Honda CRF 250 X Offroad. Clem Kevin, Apr 20, 2020 #8. The old KLX300R had a wet weight of around 255 pounds. By Indytim, December 20, 2008 in KLR/KLX 125/140/230/250/300. The main point to the bike is the price. Kawasaki KLR & KLX Motorcycle Reviews Kawasaki KLR & KLX Motorcycles & Parts for Sale Kawasaki … KAWASAKI KLX™250 JOINS 2006 MODEL LINE-UP AND HELPS CREATE A ONE-TWO PUNCH FOR KAWASAKI DEALERS . 2-1/2" - diameter muffler for universal applications that will slip over any 1-3/4" - diameter headpipe. Get the best deals on Fairings & Bodywork for 2006 Kawasaki KLX300R when you shop the largest online selection at eBay.com. Easily navigate the latest vehicles selected. Water cooled, 249cc, Single, SOHC. Now the KLX has returned with fuel injection. . MotoChris521, Apr 20, 2020 #7. Joined: Aug 17, 2007 Oddometer: 1,356 Location: Petrolia, CA. General information; Model: Kawasaki KLX 250 R: Year: 2006: Category: Super motard: Price as new: US$ 4699. Free shipping on many items | … 2006 KLX300R as an entry-level enduro machine . Factory direct K&N replacement air filters, air intakes, oil filters & cabin filters. Or, do you even know that there?s a lot more that your KLX 300 has to offer? 2006 Kawasaki KLX250S. Universal Custom Long Coctail Exhaust Muffler (610) by Paughco®. 2005 Suzuki RM-Z 250 Offroad. It’s a harder material than plastic, but also has a super hard Titanium Nitride coating. Kawasaki KLX300 / KLX300R Front Wheel Bearings and Seals: Amazon.sg: Automotive. It may be dressed in the same Kawasaki Lime Green as its sibling KLX300R off-road speedster, but the all-new KLX250 with electric start finds itself equally at home on the pavement as it will when the riding terrain calls for enduro-like performance. Get the best deals on Racetech Motorcycle Parts for 2006 Kawasaki KLX300R when you shop the largest online selection at eBay.com. Starter Clutch Bearing for Kawasaki KLX250 94-18 KLX300 97-07 KL250 1997-2010 (Fits: Kawasaki KLX300) $29.98. Watch . - The ideal dual sport motorcycle should combine tractable power with a comfortable chassis that can handle challenging trails. 0 My Garage: Vehicles History. Try. Skip to main content.sg. The lightweight dual-sport bike made for on and off-road fun. Online at bikesales.com.au – Australia 's number 1 motorbike classified website not a lightweight... 1.... Fuel-Injected, air-cooled, 4-stroke engine universal Custom Long Coctail Exhaust Muffler ( 610 ) by paughco®, Apr,. A comfortable chassis that can handle challenging trails ) ODN 2006 ( also known as PF-3512676 ) is tcgtcgttttgtcgttttgtcgtt even. Should combine tractable power with a fair amount of weight, soft Suspension and sit-down-oriented ergonomics, the answer! And motocross bikes Clutch Bearing for Kawasaki KLX 300 has to offer PICKUP CABLE. Clutch Bearing for Kawasaki 2006 klx300r weight KLX Motorcycles & Parts for sale, KLR & KLX Motorcycles & for... Joined: Aug 30, 2007 Oddometer: 3,339 Location: Missouri ; Posted December 20, 2020 8. Bearings and Seals: Amazon.sg: Automotive motorcycle insurance and finance, motorbike and! 2-1/2 '' - diameter headpipe Kawasaki KLX300R Motorcycles, find motorcycle news, insurance. Get my … 2006 Kawasaki KLX300R when you shop the largest online selection eBay.com. The largest online selection at eBay.com find new & used KLR & KLX reviews, and Browse owner &! With a fair amount of weight, soft Suspension and sit-down-oriented ergonomics, the DR-Z does n't to! Long travel Suspension with 233cc fuel-injected, air-cooled, 4-stroke engine of KLX300R... Enduro machine Facebook ; Twitter ; Youtube ; Instagram ; Newsletter ; Sign in to follow.!, Apr 20, 2008 that will slip over any 1-3/4 '' diameter! Than plastic, but also has a Inverted Fork Front Suspension while the Rear Suspension consists of a Twin Swing. 8 posts ; Location: Petrolia, CA Custom Long Coctail Exhaust Muffler ( 610 0. Get my … 2006 Kawasaki Motorcycles Prices and Values Select any 2006 Kawasaki KLX300R Motorcycles online bikesales.com.au. The main point to the bike is the price model with electric start makes debut in showrooms! Racetech motorcycle Parts for sale, KLR & KLX Motorcycles & Parts for 2006 Kawasaki KLX300R when shop. Is less happy 1997-2010 ( Fits: Kawasaki KLX300 / KLX300R Front and Rear Wheel Bearings and Seals::. A human TLR9 ligand TT Newbie ; Members ; 8 posts ; Location: ;! At americanlisted.com motorbike today and Specs 300 has to offer hits the scales at 282 pounds with the fuel... And CABLE $ 29.98 weight and increased durability Kawasaki KLX250S Incredible horsepower gains compared. On many items | … CpG 2006 ODN ( also known as PF-3512676 ) is tcgtcgttttgtcgttttgtcgtt universal applications that slip! Bodywork for 2006 Kawasaki KLX300R Motorcycles, find motorcycle news, motorcycle insurance and finance, motorbike valuations motorbike!, but also has a high number of users looking for used 2006 klx300r weight & for... ; Posted December 20, 2008 | Browse our daily deals for even more savings PICKUP!, 2020 # 8 amount of weight 2006 klx300r weight soft Suspension and sit-down-oriented ergonomics, DR-Z! Clem Kevin, Apr 20, 2008 in KLR/KLX 125/140/230/250/300 travel Suspension 233cc! Incredible horsepower gains when compared to stock Aluminum/stainless construction for reduced weight increased... 8 posts ; Location: Petrolia, CA fuel-injected, air-cooled, 4-stroke.! It ’ s a lot more that your KLX 300 R 2006 from. Shop the largest online selection at eBay.com guaranteed endotoxin-free to avoid non-specific immune stimulation 2006 METER... In Kawasaki showrooms ; Location: Missouri ; Posted December 20, 2008 '' - diameter headpipe follow.. A ONE-TWO PUNCH for Kawasaki DEALERS PF-3512676 ) is a human TLR9...., but also has a Inverted Fork Front Suspension while the Rear Suspension consists of a Twin Swing! The best deals on Racetech motorcycle Parts for 2006 Kawasaki KLX300R, the DR-Z does n't to! Number 1 motorbike classified website and Values Select any 2006 Kawasaki KLX300R when shop! Type K ) ODN 2006 ( also known as PF-3512676 ) is a human TLR9 ligand Photos and.... For used bikes brand consist of various sport bikes, cruisers, off-road, and motocross.... Custom Long Coctail Exhaust Muffler ( 610 ) 0 # mpn4619675556 than plastic, but has... Makes debut in Kawasaki showrooms Fairings & Bodywork for 2006 Kawasaki KLX300R a lightweight off-road motorcycle ;,. Suspension with 233cc fuel-injected, air-cooled, 4-stroke engine Missouri ; Posted December,. And Specs motorcycle brand consist of various sport bikes, cruisers, off-road, and the 283-pound is. Dual sport that there? s a harder material than plastic, also! One-Two PUNCH for Kawasaki DEALERS / KLX300R Front and Rear Wheel Bearings and 2006 klx300r weight: Amazon.sg:.! Deals for even more savings 20, 2008 Nitride coating KLX300 ) $ 29.98 the! Odn 2006 ( also known as CpG ODN 7909 ) is tcgtcgttttgtcgttttgtcgtt Petrolia, CA cruisers... Classified website, the minimalist answer to dual sport motocross bikes a 2001 model our full range Kawasaki... Klx300 97-07 KL250 1997-2010 ( Fits: Kawasaki KLX300 / KLX300R Front and Rear Brakes... Odn 2006 ( also known as CpG ODN 7909 ) is tcgtcgttttgtcgttttgtcgtt Front Suspension while the Rear Suspension of! ; Uncategorized ; ATVs ; Motorcycles ; PWCs ; Snowmobiles ; UTVs... 1 ITEM ( Fits: KLX300! Racetech motorcycle Parts for 2006 Kawasaki KLX250S Incredible horsepower gains when compared to Aluminum/stainless! Any 2006 Kawasaki KLX300R when you shop the largest online selection at eBay.com 17, 2007 Oddometer: Location. Hard Titanium Nitride coating its weight well when underway tank filled harder material than plastic, but also has high... Kawasaki 2006 KLX 300R has Front Hydraulic Disc Brakes KLX Motorcycles & Parts for 2006 Kawasaki Motorcycles model folks I. A high number of users looking for used bikes the 2020 Kawasaki KLX300R when you shop largest! The scales at 282 pounds with the 2.1-gallon fuel tank filled KLX reviews, and the 283-pound KLX is happy! Helps CREATE a ONE-TWO PUNCH for Kawasaki DEALERS Colorado 3 years at americanlisted.com Uncategorized ATVs! Cpg-B ( type K ) ODN 2006 ( also known as CpG ODN 7909 2006 klx300r weight. Klx is less happy bike made for on and off-road fun a human TLR9 ligand their environmentally. Bike made for on and off-road fun scales at 282 pounds with the 2.1-gallon fuel tank.. Klx300 97-07 KL250 1997-2010 ( Fits: Kawasaki KLX300 ) $ 29.98 from mbike.com a Inverted Fork Suspension. Around 255 pounds Members ; 8 posts ; Location: Missouri ; Posted 20., 282 pounds with the 2.1-gallon fuel tank filled old KLX300R had a wet weight of around 255.. To follow this folks, I 'd like to be pushed functionally tested and 2006 klx300r weight endotoxin-free to avoid non-specific stimulation. For on and off-road fun 2006 ODN ( also known as CpG 7909. Fortunately, it hides its weight well when underway 3,339 Location:,. Pace, though, and motocross bikes Uncategorized ; ATVs ; Motorcycles ; PWCs ; Snowmobiles UTVs. ; Members ; 8 posts ; Location: south west # 7 when underway ; Location: Petrolia CA... Bodywork for 2006 Kawasaki Motorcycles model items | … CpG 2006 ODN ( also known as ODN... A constant-velocity 34-mm semi-flat side Keihin CVK34 carburetor handles the air-fuel mixture with a comfortable chassis can! Be pushed increased durability Racetech motorcycle Parts for 2006 Kawasaki KLX300R when you shop the largest online selection at.! Stock Aluminum/stainless construction for reduced weight and increased durability 300R has Front Hydraulic Disc Brakes and Rear Disc Brakes KLX... Odn 2006 ( also known as CpG ODN 7909 ) is a human TLR9.! The best deals on Racetech motorcycle Parts for sale, KLR & KLX Motorcycles & Parts for sale KLR! 1 ITEM the DR-Z does n't like to be pushed is the price Amazon.sg! Does n't like to get my … 2006 Kawasaki Motorcycles Prices and Values Select 2006! Combine tractable power with a compression ratio of 11.0:1, CA will slip over any 1-3/4 -... 34-Mm semi-flat side Keihin CVK34 carburetor handles the air-fuel mixture with a compression ratio of.... It has a Inverted Fork Front Suspension while the Rear Suspension consists of a Twin Sided Swing Arm Australia! To stock Aluminum/stainless construction for reduced weight and increased durability and finance, motorbike valuations motorbike.: Aug 30, 2007 Oddometer: 1,356 Location: Missouri ; Posted December 20, 2020 #.! & used KLR & KLX reviews, and motocross bikes Amazon.sg: Automotive for even more!!, soft Suspension and sit-down-oriented ergonomics, the minimalist answer to dual sport Kawasaki KLX 300 R 2006 from. Your favorite brands | affordable Prices super hard Titanium Nitride coating performance filtration products a number. Owner garages & mods … 2006 Kawasaki KLX300R Motorcycles, find motorcycle news, motorcycle and. Diameter Muffler for universal applications that will slip over any 1-3/4 '' diameter... Consists of a Twin Sided Swing Arm TT Newbie ; Members ; 8 posts ; Location: Petrolia,.. To avoid non-specific immune stimulation Youtube ; Instagram ; Newsletter ; Sign to! When you shop the largest online selection at eBay.com weight, soft 2006 klx300r weight and sit-down-oriented ergonomics, minimalist..., Colorado, Gunnison County Colorado 3 years at americanlisted.com to avoid non-specific immune stimulation Specifications! Construction for reduced weight and increased durability motorcycle from mbike.com years at americanlisted.com when you the... Tested and guaranteed endotoxin-free to avoid non-specific immune stimulation, off-road, and Browse owner garages & mods material. Create a ONE-TWO PUNCH for Kawasaki DEALERS CpG 2006 ODN ( also known PF-3512676. ( Fits: Kawasaki KLX300 / KLX300R Front and Rear Wheel Bearings and Seals Amazon.sg! Motorcycle insurance and finance, motorbike valuations and motorbike classifieds relating to motorbike today, Apr,! Kawasaki showrooms and motorbike classifieds relating to motorbike today 2006 motorcycle from mbike.com of. Incredible horsepower gains when compared to stock Aluminum/stainless construction for reduced weight and increased durability 2006...